Catch A Criminal - Text Only Version
Three suspects. One sample of DNA evidence. Find out how
DNA can be used to catch a criminal.
This activity simulates the process by which DNA evidence is used
to identify suspected criminals using the FBI's DNA identification
system, CODIS...
How Can DNA Sequences Identify Individuals?
Most people share very similar gene sequences, but some regions
of DNA sequence have been found to vary from person to person with
high frequency. Comparing variation in these regions allows us
to answer the question of whether two different DNA samples come
from the same person.
The FBI's forensic DNA identification system probes thirteen such
regions in the genome. Sequences in these special regions involve
multiple repetitions of short combinations of letters, such as
GATA. Easily detectable differences between people lie in the number
of repeats that occur in both copies of their DNA in these regions.
For example, at one of these regions a person might have inherited
four repeats (GATAGATAGATAGATA) from their father and six repeats
(GATAGATAGATAGATAGATAGATA) from their mother at the same location
in the genome. Another person might inherit eight repeats (GATAGATAGATAGATAGATAGATAGATAGATA)
from their father and five repeats (GATAGATAGATAGATAGATA) from
their mother.
When two DNA samples match completely in a large number of regions,
such as the 13 used in the FBI's CODIS system, the probability
that they could have come from two unrelated people is virtually
zero. This fact makes DNA identification extremely reliable.
SUSPECT 1
Compare the DNA evidence from the crime scene (SAMPLE) to the
DNA profiles of the suspects using CODIS sites. When DNA samples
match completely at the 13 regions used in the FBI's CODIS system,
the probability that they could have come from two unrelated people
is virtually zero.
Suspect 1 matches the evidence in 5 of the 26 sites. Suspect 1
is not an exact match.
SUSPECT 2
Compare the DNA evidence from the crime scene (SAMPLE) to the
DNA profiles of the suspects using CODIS sites. When DNA samples
match completely at the 13 regions used in the FBI's CODIS system,
the probability that they could have come from two unrelated people
is virtually zero.
Suspect 2 matches the evidence in 11 of the 26 sites. Suspect
2 is not an exact match.
SUSPECT 3
Compare the DNA evidence from the crime scene (SAMPLE) to the
DNA profiles of the suspects using CODIS sites. When DNA samples
match completely at the 13 regions used in the FBI's CODIS system,
the probability that they could have come from two unrelated people
is virtually zero.
Suspect 3 matches the evidence in 26 or the 26 sites. Suspect
3 is an exact match.
Whose DNA is it?
Only the perpetrator, Suspect 3, could be a perfect match. Surprisingly,
the closest blood relatives, such as two siblings or a parent and
child, are unlikely to match even half of the sites. Suspect 2,
the perpetrator's brother, matched at only 11 of the 26 sites.
Strangers are unlikely to match at more than a few sites.
What does a match mean?
DNA identification is based on probabilities. Consider the case of
just three CODIS sites. The probability that someone would match
a random DNA sample at any one site is roughly one in ten (1/10).
So the probability that someone would match at three sites would
be about one in a thousand: 1/10 x 1/10 x 1/10 = 1/1000 Applying
this probability equation to all 13 CODIS sites would mean that the
chances of matching a random DNA sample are about one in ten trillion:
1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10
x 1/10 x 1/10 x 1/10 x = 1/10,000,000,000,000 Actual probabilities
vary, depending on several factors. But the probability of two different
people matching at all 13 CODIS sites is virtually zero.
|
