Skip to contentSkip to top navigationSkip to sub navigation Marian Koshland Science Museum of the National Academy of Sciences
Site Map Contact Us
Search
Home   Plan Your Visit   Exhibits   Teach & Learn     News   About
Putting DNA to Work
  DNA/CRIMINAL JUSTICE

How Can DNA Sequences Identify Individuals?

1 2 3 4 5


Most people share very similar gene sequences, but some regions of DNA sequence have been found to vary from person to person with high frequency. Comparing variation in these regions allows us to answer the question of whether two different DNA samples come from the same person.

The FBI’s forensic DNA identification system probes thirteen such regions in the genome. Sequences in these special regions involve multiple repetitions of short combinations of letters, such as GATA. Easily detectable differences between people lie in the number of repeats that occur in both copies of their DNA in these regions. For example, at one of these regions a person might have inherited four repeats (GATAGATAGATAGATA) from their father and six repeats (GATAGATAGATAGATAGATAGATA) from their mother at the same location in the genome. Another person might inherit eight repeats (GATAGATAGATAGATAGATAGATAGATAGATA) from their father and five repeats (GATAGATAGATAGATAGATA) from their mother.

When two DNA samples match completely in a large number of regions, such as the 13 used in the FBI’s CODIS system, the probability that they could have come from two unrelated people is virtually zero. This fact makes DNA identification extremely reliable.

Human chromosomes with 13 CODIS sites

Injustice Corrected

It takes both sequences at all 13 sites to prove a DNA match, but it only takes one sequence to prove a mismatch. DNA evidence has been used to liberate a growing number of people who were falsely imprisoned for crimes they did not commit.


1 2 3 4 5
What Does A Match Mean? [ next ]

 

Print this Page

The National Academies - Advisers to the Nation on Science, Engineering, and Medicine Back to Top
HOME | PLAN YOUR VISIT | EXHIBITS | TEACH & LEARN | EVENTS | NEWS | ABOUT